Journal: Cell reports. Medicine

Article Title: Bioengineering the metabolic network of CAR T cells with GLP-1 and Urolithin A increases persistence and long-term anti-tumor activity.

doi: 10.1016/j.xcrm.2025.102021

Figure Lengend Snippet: Figure 4. Analysis of mTOR activity, autophagy, and CAR T cell function (A) mTOR activity measured by flow cytometry in CAR T cells treated with VEH, SG (Scram and GRshRNA transduced), and MHY1485 as positive control (n = 6). (B) MFI of CYTO-ID (n = 6). (C and D) IL-2 secretion (C) and Granzyme B expression (D) measured by ELISA and flow cytometry, respectively, in CAR T cells transduced with Scram and GRshRNA or treated with VEH or MHY1485 cultured in the presence of SG (n = 6). (E) Analysis of CAR T cell persistence under various conditions. (F) Similarly, percentage of cancer cell survival after co-culture with CAR T cells (n = 5). (G1 and G2) Representative images of LC3 staining (green) showing autophagosome formation in CAR T cells treated with VEH, SG, UrA, SG + UrA, and nGLP-1. Red arrows indicate LC3 puncta. Quantification of LC3 puncta per cell is shown in (G2) (n = 14 images). (H1 and H2) Western blot analysis of LC3-I and LC3-II expression in CAR T cells. Quantification of LC3-II/LC3-I ratio is shown in (H2) (n = 5). (I) Schematic representation of the FRET-LC3II plasmid construction. The relative fluorescence unit (RFU) ratio of 530–475 nm (YFP/CFP) was calculated to quantify the extent of LC3B cleavage, where a decrease in the ratio indicated increased substrate cleavage. (J) FRET analysis using a CFP-LC3-YFP reporter. In vitro assay conducted by incubating purified Atg4b protein with CFP-LC3-YFP in the presence of VEH, UrA, SG, or nGLP-1. FRET signals were recorded at 0, 5, and 15 min (n = 5). (K) Structural model of Atg4b interaction with its substrates, highlighting key amino acids involved in the interaction, based on in silico docking predictions. (L) Fluorescence intensity (RFU ratio 530 nm/475 nm) over time in CAR T cells expressing wild-type and mutated forms (T28A, H300A, and L11A) of Atg4b, treated with UrA (n = 5). (M) Relative expression of LC3 normalized to ACTB in CAR T cells transduced with Scram or LC3-targeted shRNA (n = 5). (N) Ratio of LTDR/MTG after FCCP treatment for 60 min (n = 8). (O) MFI of Atg14 in CAR T cells after treatment (n = 6). Data represent mean ± SEM.*p < 0.01; **p < 0.01; ****p < 0.0001; (ns, not significant). A non-parametric t test was used for statistical analysis. Scale bar: 50 mm.

Article Snippet: The shRNA plasmid for mTOR was obtained from Addgene and used in the study (Plasmid #1855).

Techniques: Activity Assay, Cell Function Assay, Cytometry, Positive Control, Expressing, Enzyme-linked Immunosorbent Assay, Transduction, Cell Culture, Co-Culture Assay, Staining, Western Blot, Plasmid Preparation, In Vitro, In Silico, Fluorescence, shRNA

Journal: Cell reports. Medicine

Article Title: Bioengineering the metabolic network of CAR T cells with GLP-1 and Urolithin A increases persistence and long-term anti-tumor activity.

doi: 10.1016/j.xcrm.2025.102021

Figure Lengend Snippet: Figure 4. Analysis of mTOR activity, autophagy, and CAR T cell function (A) mTOR activity measured by flow cytometry in CAR T cells treated with VEH, SG (Scram and GRshRNA transduced), and MHY1485 as positive control (n = 6). (B) MFI of CYTO-ID (n = 6). (C and D) IL-2 secretion (C) and Granzyme B expression (D) measured by ELISA and flow cytometry, respectively, in CAR T cells transduced with Scram and GRshRNA or treated with VEH or MHY1485 cultured in the presence of SG (n = 6). (E) Analysis of CAR T cell persistence under various conditions. (F) Similarly, percentage of cancer cell survival after co-culture with CAR T cells (n = 5). (G1 and G2) Representative images of LC3 staining (green) showing autophagosome formation in CAR T cells treated with VEH, SG, UrA, SG + UrA, and nGLP-1. Red arrows indicate LC3 puncta. Quantification of LC3 puncta per cell is shown in (G2) (n = 14 images). (H1 and H2) Western blot analysis of LC3-I and LC3-II expression in CAR T cells. Quantification of LC3-II/LC3-I ratio is shown in (H2) (n = 5). (I) Schematic representation of the FRET-LC3II plasmid construction. The relative fluorescence unit (RFU) ratio of 530–475 nm (YFP/CFP) was calculated to quantify the extent of LC3B cleavage, where a decrease in the ratio indicated increased substrate cleavage. (J) FRET analysis using a CFP-LC3-YFP reporter. In vitro assay conducted by incubating purified Atg4b protein with CFP-LC3-YFP in the presence of VEH, UrA, SG, or nGLP-1. FRET signals were recorded at 0, 5, and 15 min (n = 5). (K) Structural model of Atg4b interaction with its substrates, highlighting key amino acids involved in the interaction, based on in silico docking predictions. (L) Fluorescence intensity (RFU ratio 530 nm/475 nm) over time in CAR T cells expressing wild-type and mutated forms (T28A, H300A, and L11A) of Atg4b, treated with UrA (n = 5). (M) Relative expression of LC3 normalized to ACTB in CAR T cells transduced with Scram or LC3-targeted shRNA (n = 5). (N) Ratio of LTDR/MTG after FCCP treatment for 60 min (n = 8). (O) MFI of Atg14 in CAR T cells after treatment (n = 6). Data represent mean ± SEM.*p < 0.01; **p < 0.01; ****p < 0.0001; (ns, not significant). A non-parametric t test was used for statistical analysis. Scale bar: 50 mm.

Article Snippet: Daudi ATCC CCL-213 Jurkat ATCC TIB-152 Raji-mCherry-luciferase N/A This paper NALM6-mCherry-luciferase N/A This paper SHS-5Y5-mCherry-luciferase N/A This paper MM1.S mCherry-luciferase N/A This paper Jurkat mitophagy reporter N/A This paper Jurkat autophagy reporter N/A This paper Experimental models: Organisms/strains NOD.Cg-Prkdĉ scid Il2rĝ tm1Wjl/SzJ The Jackson Laboratory 005557 C.B.Igh-1b/GbmsTacPrkdĉ scidLyst̂ bgN7 Taconic Biosciences 491 Oligonucleotides BECN1 shRNA This paper Table S6 ATG14 shRNA This paper Table S6 GLP-1R shRNA This paper Table S6 mTOR shRNA Sarbassov et al.63 Addgene #1855 BECN1 Primers: This paper Table S6 ATG14 Primers This paper Table S6 GLP-1R Primers This paper Table S6 CD19 ScFv Primers This paper Table S6 mTOR Primers This paper Table S6 Recombinant DNA pCLBW cox8 EGFP mCherry Rojansky et al.31 Addgene #78520 pCDH-EF1a-mCherry-EGFP-LC3B Wulansari et al.64 Addgene #170446 LC3-mCherry (LC3-mCherry plasmid) This Paper N/A pLYS1-FLAG-MitoGFP-HA Sancak et al.65 Addgene #50057 CD19 CAR scFv sequence plasmid This Paper N/A (Continued on next page) e3 Cell Reports Medicine 6, 102021, March 18, 2025

Techniques: Activity Assay, Cell Function Assay, Cytometry, Positive Control, Expressing, Enzyme-linked Immunosorbent Assay, Transduction, Cell Culture, Co-Culture Assay, Staining, Western Blot, Plasmid Preparation, In Vitro, In Silico, Fluorescence, shRNA

Journal: Cell Reports Medicine

Article Title: Bioengineering the metabolic network of CAR T cells with GLP-1 and Urolithin A increases persistence and long-term anti-tumor activity

doi: 10.1016/j.xcrm.2025.102021

Figure Lengend Snippet:

Article Snippet: mTOR shRNA , Sarbassov et al. , Addgene #1855.

Techniques: Virus, Recombinant, Lysis, Modification, Activity Assay, Cobalt Assay, Enzyme-linked Immunosorbent Assay, Flow Cytometry, shRNA, Plasmid Preparation, Sequencing, Software, In Vivo Imaging

Journal: Neurochemical Research

Article Title: MTOR Promotes Astrocyte Activation and Participates in Neuropathic Pain through an Upregulation of RIP3

doi: 10.1007/s11064-025-04341-x

Figure Lengend Snippet: p-mTOR is upregulated and astrocytes are activated in a CCI-induced rat model of NP. A Protocol for generating the CCI-induced rat model of NP. B , C Mechanical allodynia and thermal hyperalgesia in the ipsilateral hind paw were determined by calculating the paw withdrawal threshold (PWT) and latency (PWL) on days 0, 3, 7, 11, 14 and 21 post-CCI. D – F Western blotting and quantification for the ratios of p-mTOR to mTOR and GFAP to GAPDH in sham and CCI rats. F(E) = 14.67, F(F) = 15.26. G , H Double-immunofluorescence of p- mTOR (red staining) and GFAP, IBA1 and NEUN (green staining) in the spinal cord of sham and CCI rats. Histogram illustrated that p- mTOR co-localization with GFAP was increased in CCI rats. (*p < 0.05, n = 6 in each group)

Article Snippet: The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C.

Techniques: Western Blot, Immunofluorescence, Staining

Journal: Neurochemical Research

Article Title: MTOR Promotes Astrocyte Activation and Participates in Neuropathic Pain through an Upregulation of RIP3

doi: 10.1007/s11064-025-04341-x

Figure Lengend Snippet: Inhibition of MTOR prevents CCI-induced allodynia and neuroinflammation. A An illustration of the experimental scheme. B , C Mechanical allodynia and thermal hyperalgesia in the ipsilateral hind paw was determined using the PWT and PWL on days 0, 3, 7 and 14 post-CCI in rats treated with rapamycin. D , E Western blotting and quantification for the ratios of p-mTOR to mTOR in sham and CCI rats treated with the mTOR inhibitor, rapamycin. F = 15.95. F , G mRNA levels of IL-6 (F) and IL-1β (G) in CCI rats treated with rapamycin. F(F) = 30.98, F(G) = 24.72. H , I TNF-α was assessed using immunohistochemistry in sham and CCI rats treated with rapamycin. F = 19.22. (*p < 0.05, n = 6 in each group)

Article Snippet: The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C.

Techniques: Inhibition, Western Blot, Immunohistochemistry

Journal: Neurochemical Research

Article Title: MTOR Promotes Astrocyte Activation and Participates in Neuropathic Pain through an Upregulation of RIP3

doi: 10.1007/s11064-025-04341-x

Figure Lengend Snippet: Astrocytic reduction of mTOR increases glutamate clearance and attenuates spinal dorsal horn neuron activity induced by CCI. A An illustration of the experimental scheme. B , C Effect of a reduction in the expression of astrocytic mTOR on mechanical allodynia and thermal hyperalgesia as evaluated using PWT and PWL. D , E Western blotting and quantification of the mTOR to GAPDH ratio in the spinal dorsal horn of rats with a reduction in the expression of astrocytic mTOR. F = 11.57. F mRNA levels of the mTOR in the spinal dorsal horn of rats with a reduction in the expression of astrocytic mTOR. F = 6.698. G , H The double-immunofluorescence of mTOR (green staining) with GFAP (red staining) in the spinal dorsal horn. Histogram illustrated that mTOR co-localization with GFAP was decreased in rats treated with mTOR-shRNA. I The colocalization immunofluorescence of GFP (green staining) with GFAP (red staining), IBA1 (red staining), and NEUN (red staining). J , K Spinal glutamine synthetase (GS) expressions were determined and quantified using Western blotting. F = 11.68. L , M Double-immunofluorescence of c-fos (red staining) and NEUN (green staining) in each group. c-fos–positive neurons were quantified and normalized to that of the vehicle group. F = 121.3. (*p < 0.05, n = 6 in each group)

Article Snippet: The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C.

Techniques: Activity Assay, Expressing, Western Blot, Immunofluorescence, Staining, shRNA

Journal: Neurochemical Research

Article Title: MTOR Promotes Astrocyte Activation and Participates in Neuropathic Pain through an Upregulation of RIP3

doi: 10.1007/s11064-025-04341-x

Figure Lengend Snippet: Pharmacological inhibition of RIP3 blocks the mTOR overexpression-induced astrocyte activation. A mRNA levels of TSC2 in astrocytes before and after transfection with TSC2-shRNA. F = 32.76. B , C Protein expression of TSC2 in astrocytes before and after transfection with TSC2-shRNA. F = 21.21. D GFP fluorescence in astrocytes transfected with TSC2-shRNA. E – G Western blotting and quantification of ratios of TSC2 and RIP3 to GAPDH in astrocytes treated with TSC2-shRNA or add GSK872 (5 μM) for 24 h. F(F) = 13.89, F(G) = 15.51. H – J Immunofluorescent staining of p-mTOR (J) and RIP3 (I) in astrocytes treated with TSC2-shRNA or add GSK872 (5 μM) for 24 h. F(I) = 11.68, F(J) = 12.97. K , L mRNA levels of S100A10 (K) and C3d (L) in astrocytes treated with TSC2-shRNA or add GSK872 (5 μM) for 24 h. F(K) = 17.61, F(L) = 12.15. (*p < 0.05, n = 3 in each group)

Article Snippet: The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C.

Techniques: Inhibition, Over Expression, Activation Assay, Transfection, shRNA, Expressing, Fluorescence, Western Blot, Staining

Journal: Neurochemical Research

Article Title: MTOR Promotes Astrocyte Activation and Participates in Neuropathic Pain through an Upregulation of RIP3

doi: 10.1007/s11064-025-04341-x

Figure Lengend Snippet: RIP3 is required for mTOR-induced neuroinflammation and astrocyte activation. A , B Double-immunofluorescence of TSC2 (red staining) and GFAP (green staining) in the spinal dorsal horn of sham and CCI rats. C – E Western blotting and quantification of the ratios of TSC2 and RIP3 to GAPDH in CCI rats treated with TSC2-shRNA or add GSK872. F(D) = 20.34, F(E) = 12.47. F , G Double-immunofluorescence showed the expression of p-JNK (red staining) and GFAP (green staining) in sham and CCI rats treated with NC-shRNA or mTOR-shRNA. F = 43.03. H , I Double-immunofluorescence images showing colocalization of GFAP-labeled astrocytes (green staining) and C3d-labeled A1 astrocytes (red staining) in CCI rats treated with TSC2-shRNA alone or with GSK872. F = 71.40. (*p < 0.05, n = 6 in each group)

Article Snippet: The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C.

Techniques: Activation Assay, Immunofluorescence, Staining, Western Blot, shRNA, Expressing, Labeling

Journal: Neurochemical Research

Article Title: MTOR Promotes Astrocyte Activation and Participates in Neuropathic Pain through an Upregulation of RIP3

doi: 10.1007/s11064-025-04341-x

Figure Lengend Snippet: MTOR modulates the ubiquitinated degradation of RIP3 via ITCH. A mRNA levels of RIP3 in astrocytes before and after transfection with TSC2-shRNA. F = 1.501. B Cell lysates from astrocytes transfected with NC-shRNA or TSC2-shRNA were immunoprecipitated with normal IgG or anti-RIP3 antibodies, then immunoblotted with their respective antibodies. C The top 20 E3 ligases of RIP3. D Prepare cell lysates and immunoprecipitate with normal IgG or anti-RIP3 antibodies. Co-IP showed the interaction of ITCH with RIP3. E Endogenous RIP3 (red staining) colocalized with ITCH (green staining) in WT astrocytes. F Lysates of cells treated with NC-siRNA or ITCH-siRNA were subjected to immunoprecipitation with normal IgG or anti-RIP3 antibodies. G – I Western blotting demonstrated the ITCH dependency of mTOR mediated RIP3 ubiquitination. (*p < 0.05, n = 3 in each group)

Article Snippet: The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C.

Techniques: Transfection, shRNA, Immunoprecipitation, Co-Immunoprecipitation Assay, Staining, Western Blot

Journal: Neurochemical Research

Article Title: MTOR Promotes Astrocyte Activation and Participates in Neuropathic Pain through an Upregulation of RIP3

doi: 10.1007/s11064-025-04341-x

Figure Lengend Snippet: The mTOR/ITCH axis modulates the ubiquitination and degradation of RIP3 via the autophagy pathway. A – C RIP3 and p62 protein levels were determined using western blotting of cell lysates from NC-shRNA and TSC2-shRNA astrocytes treated with amino acid–free Earle’s balanced salt solution (EBSS) medium at the various times indicated. D Prepare cell lysates and immunoprecipitate with normal IgG or anti-RIP3 antibodies. E Endogenous p62 (red staining) colocalized with ITCH (green staining) in WT astrocytes. F HEK 293 T cells overexpressing FLAG-RIP3 alone or with HA-ITCH were either treated or not with 10 μM chloroquine (CQ, 18 h) or 10 μM (MG132, 6 h), respectively, with cell lysates then probed with anti-RIP3. (*p < 0.05, n = 3 in each group)

Article Snippet: The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C.

Techniques: Western Blot, shRNA, Staining

Journal: Neurochemical Research

Article Title: MTOR Promotes Astrocyte Activation and Participates in Neuropathic Pain through an Upregulation of RIP3

doi: 10.1007/s11064-025-04341-x

Figure Lengend Snippet: A functional model demonstrating how neuropathic pain is induced by astrocytic mTOR. Note: mTOR is overactived following the loss of TSC2’s negative regulation of it after chronic constriction injury, which results in the inhibition of ITCH activity and autophagy biogenesis. Due to the lack of degradation, RIP3 can be highly accumulated in the astrocytes, leading to the release of inflammatory factors. Finally, neuroinflammation induced the increased neuronal activity and enhancement of neuropathic pain

Article Snippet: The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C.

Techniques: Functional Assay, Inhibition, Activity Assay